| Gene name |
SPBP8B7.29 |
| Gene ID |
37/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
para-aminobenzoate
synthase; involved in folate biosynthesis; involved in
para-aminobenzoic acid metabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2157 |
| ORF length (spliced) |
|
| Entry clone length |
2157 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1633A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.29.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAAATTTCAAACCG |
| Rev primer name |
SPBP8B7.29.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTACATGATCTTTTTTTA |
| Amino acid length |
718 |
| Molecular weight |
80.5 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNRIWQLNI/LKIFKNFLSL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |