| Gene name |
SPCC663.14c |
| Gene ID |
37/F04 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
similar to Sp SPAC1F7.03 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2153 |
| ORF length (spliced) |
2064 |
| Entry clone length |
2153 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
317G:A / 1243T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC663.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCTAATACTCTTAGC |
| Rev primer name |
SPCC663.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAGTACGCTGCATTTCA |
| Amino acid length |
687 |
| Molecular weight |
77.2 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTNLFTLTL/LLLALLFGLFL/LTRVVSFALLI |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |