| Gene name |
SPCC126.02c |
| Gene ID |
37/D11 |
| Gene synonyms/obsolete |
pku70 |
| Gene product |
DNA helicase; Ku
domain protein; involved in DNA repair; involved in
double-strand break repair; involved in telomere maintenance
(required); involved in control of replication timing in
telomeric regions; interacts physically with pku80p; forms a
heterodimer with pku80p; DNA-binding protein; telomere binding
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
2132 |
| ORF length (spliced) |
1824 |
| Entry clone length |
2132 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
960A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC126.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAACGATGAACAAAT |
| Rev primer name |
SPCC126.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATTTTTTGACATAGTTC |
| Amino acid length |
607 |
| Molecular weight |
69 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |