Gene name |
SPCC970.10c |
Gene ID |
37/D01 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); E3 ubiquitin ligase; similar to
Sp SPCC1919.15; involved in ubiquitination; involved in
histone H2B monoubiquitination |
Entry clone |
Cloned |
ORF length (unspliced) |
2107 |
ORF length (spliced) |
2043 |
Entry clone length |
2107 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
312T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC970.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATCAGAATGGTAAACC |
Rev primer name |
SPCC970.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGATGTATCGGAATAACA |
Amino acid length |
680 |
Molecular weight |
78 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVDLNDLEL |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |