Gene name |
SPBC1734.03 |
Gene ID |
37/C06 |
Gene synonyms/obsolete |
SPBC337.19 |
Gene product |
dihydropteroate
synthase; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine
diphosphokinase; 7,
8-dihydro-6-hydroxymethylpterin-pyrophosphokinase; HPPK;
dihydroneopterin aldolase; trifunctional enzyme; involved in
folate biosynthesis (1st step) (2nd step) |
Entry clone |
Cloned |
ORF length (unspliced) |
2061 |
ORF length (spliced) |
|
Entry clone length |
2061 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
11T:A / 549T:C /
977A:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1734.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTTGATACATGACAC |
Rev primer name |
SPBC1734.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGTACGTAACGTATAGCA |
Amino acid length |
686 |
Molecular weight |
76.3 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |