| Gene name |
SPAC222.10c |
| Gene ID |
37/B08 |
| Gene synonyms/obsolete |
byr4 |
| Gene product |
involved in spindle
assembly checkpoint; involved in cytokinesis; involved in
septation (regulation) (negative); two-component GAP for the
GTPase spg1 (with cdc16); suppressor of ras1; dosage-dependent
inhibitor of cytokinesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1998 |
| ORF length (spliced) |
|
| Entry clone length |
1998 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC222.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGAAGTTGAATGCTG |
| Rev primer name |
SPAC222.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGTTCGGCATTAAGTATA |
| Amino acid length |
665 |
| Molecular weight |
75.6 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |