Gene name |
SPBC2D10.04 |
Gene ID |
37/B06 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
similar to Sp SPBC839.02 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1977 |
ORF length (spliced) |
|
Entry clone length |
1977 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
4A:G / 1431G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2D10.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGGGCGAATTGAATAT |
Rev primer name |
SPBC2D10.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTAGGGATTTCAAAGCTT |
Amino acid length |
658 |
Molecular weight |
72.7 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKALLVLSI |
Localization (YFP) |
cytosol; cytoplasmic
dots; periphery at cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |