Gene name |
SPAC17H9.06c |
Gene ID |
37/A09 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
erine-rich protein; sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
1933 |
ORF length (spliced) |
1806 |
Entry clone length |
1933 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
46T:C / 284A:G /
930T:C / 1258T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17H9.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATCAAATCAAGACAA |
Rev primer name |
SPAC17H9.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATTGAGGAACGGCTATGG |
Amino acid length |
601 |
Molecular weight |
68.7 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
198 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |