Gene name |
SPBC1271.12 |
Gene ID |
36/H03 |
Gene synonyms/obsolete |
kes1 |
Gene product |
oxysterol binding
protein; involved in ergosterol biosynthesis; similar to Sp
SPBC646.08c and SPBC354.07c and SPCC23B6.01; non-essential
|
Entry clone |
Cloned |
ORF length (unspliced) |
1848 |
ORF length (spliced) |
1167 |
Entry clone length |
1848 |
No. of intron |
6 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1271.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAAAACAACGAGTTC |
Rev primer name |
SPBC1271.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTAAGATAATACCAGAAA |
Amino acid length |
388 |
Molecular weight |
44.5 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at site of
septum formation; ambiguous structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |