Gene name |
SPAC56E4.06c |
Gene ID |
36/G04 |
Gene synonyms/obsolete |
|
Gene product |
gamma-glutamyltranspeptidase; similar to Sp
SPAC664.09 |
Entry clone |
Cloned |
ORF length (unspliced) |
1836 |
ORF length (spliced) |
|
Entry clone length |
1836 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
901G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC56E4.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCCTACAGACACTAC |
Rev primer name |
SPAC56E4.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAAGCGGCAGCCTGACCG |
Amino acid length |
611 |
Molecular weight |
67.8 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAQVGPLSI |
Localization (YFP) |
vacuole |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |