Gene name |
SPBC646.11 |
Gene ID |
36/F12 |
Gene synonyms/obsolete |
cct6 |
Gene product |
chaperonin-containing
T-complex; T-complex protein 1 (zeta subunit); chaperone;
involved in protein folding; involved in actin folding;
involved in tubulin folding |
Entry clone |
Cloned |
ORF length (unspliced) |
1832 |
ORF length (spliced) |
1608 |
Entry clone length |
1832 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
613C:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC646.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGTCCTTATTGAATCC |
Rev primer name |
SPBC646.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGAGGTGGGCCTTCTTTA |
Amino acid length |
535 |
Molecular weight |
58.5 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |