Gene name |
SPAC57A10.05c |
Gene ID |
36/F07 |
Gene synonyms/obsolete |
pof1 |
Gene product |
F-box protein;
involved in sulfur metabolism; involved in protein
ubiquitination |
Entry clone |
Cloned |
ORF length (unspliced) |
1818 |
ORF length (spliced) |
|
Entry clone length |
1818 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
781C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC57A10.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACAGGTTATGAATC |
Rev primer name |
SPAC57A10.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGATTGAATCGACACATCG |
Amino acid length |
605 |
Molecular weight |
67.1 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVRLDFLSL |
Localization (YFP) |
nucleus |
Comments for localization |
one nuclear dot by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |