| Gene name |
SPBC660.14 |
| Gene ID |
36/F03 |
| Gene synonyms/obsolete |
mik1 |
| Gene product |
serine/threonine
protein kinase; mitosis inhibitor protein kinase; involved in
DNA replication checkpoint; involved in DNA damage checkpoint;
inhibitory tyrosine phosphorylation of cdc2 on tyrodine 15;
expressed at G1-S phase; regulated by DSC1/MBF complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1814 |
| ORF length (spliced) |
1746 |
| Entry clone length |
1814 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
138A:G / 955G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC660.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCATCAACCACCAT |
| Rev primer name |
SPBC660.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCTAACCAACTGTTA |
| Amino acid length |
581 |
| Molecular weight |
65.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLFLSELGL/LPNLKDLLL |
| Localization (YFP) |
nucleus>cytosol;
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |