Gene name |
SPAC22F8.10c |
Gene ID |
36/E05 |
Gene synonyms/obsolete |
sap145 |
Gene product |
U2 snRNP component;
complexed with Cdc5p; involved in mRNA splicing |
Entry clone |
Cloned |
ORF length (unspliced) |
1806 |
ORF length (spliced) |
|
Entry clone length |
1806 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
896A:G / 1451C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22F8.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTACTTGTTGACACGTCC |
Rev primer name |
SPAC22F8.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGACGAAACTTGTCTCTC |
Amino acid length |
601 |
Molecular weight |
69.1 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |