| Gene name |
SPBC530.04 |
| Gene ID |
36/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
non-essential;
serine-rich protein; involved in cell polarity; no apparent
orthologs; carboxy-terminal prenylation signal |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1797 |
| ORF length (spliced) |
1569 |
| Entry clone length |
1797 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1784G:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC530.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGCTTTATCTGAAAG |
| Rev primer name |
SPBC530.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATCAAAATACAACAAAAC |
| Amino acid length |
522 |
| Molecular weight |
56.5 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol;
periphery at site of septum formation; a few cytoplasmic dots,
especially at cell tip |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |