| Gene name |
SPAC3H1.06c |
| Gene ID |
36/C01 |
| Gene synonyms/obsolete |
|
| Gene product |
transporter; unknown
specificity; similar to Sp SPBC16A3.17C and SPAC1399.02
(paralogs) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1770 |
| ORF length (spliced) |
|
| Entry clone length |
1770 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
9T:C / 665C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3H1.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACCCTTCGTCTTCTCC |
| Rev primer name |
SPAC3H1.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGAGCATCTTTGAATCCC |
| Amino acid length |
589 |
| Molecular weight |
63.5 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LALLIFFLNL/LCYLIFGILCI/LMSGVHTLSL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |