| Gene name |
SPAC1F12.09 |
| Gene ID |
36/A11 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
Sc YDR434W is null lethal |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1753 |
| ORF length (spliced) |
1665 |
| Entry clone length |
1753 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F12.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCCTTGTAAGTGGTT |
| Rev primer name |
SPAC1F12.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTGGCTTCGGCACGTTT |
| Amino acid length |
554 |
| Molecular weight |
63.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
34 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSFYVIILLAI/LASLAKLNI/LFAPILIPLLI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |