Gene name |
SPCC1906.02c |
Gene ID |
36/A02 |
Gene synonyms/obsolete |
|
Gene product |
role inferred from
homology; CUE domain protein; involved in the ubiquitin
system |
Entry clone |
Cloned |
ORF length (unspliced) |
1746 |
ORF length (spliced) |
|
Entry clone length |
1746 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
14T:G / 958T:C /
981T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1906.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAGAATGTCATATC |
Rev primer name |
SPCC1906.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCTCATTTGAAGCCTTT |
Amino acid length |
581 |
Molecular weight |
65.8 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEMLLDSLDL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
Microscope used for
observation |
Leica |