Gene name |
SPAC1002.11 |
Gene ID |
35/H11 |
Gene synonyms/obsolete |
|
Gene product |
GPI-anchor
transamidase complex; involved in GPI anchor biosynthesis;
involved in attachment of GPI anchor to protein |
Entry clone |
Cloned# |
ORF length (unspliced) |
1746 |
ORF length (spliced) |
|
Entry clone length |
1746 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
29G:T |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1002.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCTATTCACTTTTGT |
Rev primer name |
SPAC1002.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAAAGTCTTTGTCTTGGTT |
Amino acid length |
581 |
Molecular weight |
66.8 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
7 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQRHLFFLQL/LMPSVFMILVL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |