Gene name |
SPCC330.02 |
Gene ID |
35/H08 |
Gene synonyms/obsolete |
SPCC613.14 |
Gene product |
leucine-rich repeat
protein; involved in DNA repair and nucleotide-excision
repair |
Entry clone |
Cloned |
ORF length (unspliced) |
1740 |
ORF length (spliced) |
1692 |
Entry clone length |
1740 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC330.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAGTGGAAGTCGGGT |
Rev primer name |
SPCC330.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGAACTTCACGCCCTATC |
Amino acid length |
563 |
Molecular weight |
62.7 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
164 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |