| Gene name |
SPCC4G3.05c |
| Gene ID |
35/F02 |
| Gene synonyms/obsolete |
mus81 |
| Gene product |
endodeoxyribonuclease
RUS activity; Holliday junction resolvase; involved in DNA
repair, nucleotide-excision repair, and nucleotide-excision
repair, DNA damage recognition; interacts physically with
Cds1p; XP-F family?; involved in meiotic recombination
(required) (late step) and the processing of stalled and
collapsed replication forks |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1719 |
| ORF length (spliced) |
|
| Entry clone length |
1719 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1513A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC4G3.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGTTGCCCCATCAC |
| Rev primer name |
SPCC4G3.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATTCTGGAAAGAAAACG |
| Amino acid length |
572 |
| Molecular weight |
64.5 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVIPDLSI |
| Localization (YFP) |
nuclear dots; nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |