Gene name |
SPBC947.05c |
Gene ID |
35/C12 |
Gene synonyms/obsolete |
|
Gene product |
ferric reductase
transmembrane component; similar to Sp frp1 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1695 |
ORF length (spliced) |
|
Entry clone length |
1695 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC947.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTTAGCTAGAGATGA |
Rev primer name |
SPBC947.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAGCTCTTCATAGTGCTGG |
Amino acid length |
564 |
Molecular weight |
65.2 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLIGFALLFL/LPILRDLIL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |