| Gene name |
SPCC548.07c |
| Gene ID |
35/A08 |
| Gene synonyms/obsolete |
ght1 |
| Gene product |
hexose transporter;
similar to Sp GHT3, GHT2, GHT4, GHT5, GHT6, SPCC548.06C and
SPBC1348.14C |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1674 |
| ORF length (spliced) |
|
| Entry clone length |
1674 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC548.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAAGACATTGACCAT |
| Rev primer name |
SPCC548.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTGGAGGAGGTTGTGTAT |
| Amino acid length |
557 |
| Molecular weight |
61.6 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEINELYL |
| Localization (YFP) |
periphery with
discontinuity |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |