Gene name |
SPBC1683.08 |
Gene ID |
35/A06 |
Gene synonyms/obsolete |
ght4 |
Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT3 and GHT5 and GHT6 and
SPCC548.06C and SPBC1348.14C |
Entry clone |
Cloned |
ORF length (unspliced) |
1674 |
ORF length (spliced) |
|
Entry clone length |
1674 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
385G:A / 1253T:C /
1281T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1683.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAGAACACTTACATC |
Rev primer name |
SPBC1683.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCCAAGTCGGGTGTGAT |
Amino acid length |
557 |
Molecular weight |
62.1 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
9 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at site of
septum formation and scar; cytoplasmic dots and periphery by
over expression |
Comments for localization |
discontinuous
membrane |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |