Gene name |
SPAC30D11.08c |
Gene ID |
34/H08 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-PHD finger; involved in transcriptional regulation; similar
to Sp SPCC4G3.07C (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1666 |
ORF length (spliced) |
1617 |
Entry clone length |
1666 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
314A:T / 515A:G /
1371T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30D11.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGAATTCATCGTACTA |
Rev primer name |
SPAC30D11.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATACTACTAAGAACAATT |
Amino acid length |
538 |
Molecular weight |
60.6 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |