| Gene name |
SPCC548.06c |
| Gene ID |
34/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT4 and GHT5 and GHT6 and
GHT3 and SPBC1348.14C; tandem duplication |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
1644 |
| ORF length (spliced) |
|
| Entry clone length |
1644 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC548.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAGACATTGACCAT |
| Rev primer name |
SPCC548.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCGTAGCGATCTTGTTCA |
| Amino acid length |
547 |
| Molecular weight |
60.1 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEINELYL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |