Gene name |
SPCC1672.05c |
Gene ID |
34/E02 |
Gene synonyms/obsolete |
|
Gene product |
tyrosine-tRNA ligase;
involved intyrosyl-tRNA aminoacylation; tyrosine-tRNA ligase
activity |
Entry clone |
Cloned |
ORF length (unspliced) |
1206 |
ORF length (spliced) |
|
Entry clone length |
1206 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
852A:G / 950T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1672.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCTTACTCCGGATGA |
Rev primer name |
SPCC1672.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCATCCAGATTCAATTTT |
Amino acid length |
401 |
Molecular weight |
44.5 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol (intranuclear microtubule
bundle?) |
Microscope used for
observation |
Confocal |