Gene name |
SPBC646.01c |
Gene ID |
34/C09 |
Gene synonyms/obsolete |
tor2;
SPBC216.07c |
Gene product |
phosphatidylinositol
kinase; similar to Sp TOR1 (paralog); involved in starvation
response (required); involved in stress response |
Entry clone |
Cloned |
ORF length (unspliced) |
7014 |
ORF length (spliced) |
|
Entry clone length |
7014 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
489T:C / 3778T:C /
4331A:G / 5638T:A / 7007T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC646.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAATTTCCTGGGTT |
Rev primer name |
SPBC646.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCAGAAACTACACCAGCCA |
Amino acid length |
2337 |
Molecular weight |
266.3 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKIMLKTLTI/LEFYFQQLSI/LPSLLVMMLQI/LQDTLRLLNL/LPQLTTLDL/LLHVHDLEL/LFGLCNNLLL/LLNIEHRLII |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |