Gene name |
SPAC22G7.06c |
Gene ID |
34/C07 |
Gene synonyms/obsolete |
ura1 |
Gene product |
ATP-binding protein;
involved in glutamate metabolism; involved in pyrimidine base
biosynthesis; involved in aspartate metabolism;
carbamoyl-phosphate synthase (glutamine hydrolyzing) activity;
aspartate carbamoyltransferase activity; transferase activity,
transferring pentosyl groups; dihydroorotase activity |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
6735 |
ORF length (spliced) |
|
Entry clone length |
6735 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22G7.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGGATTGCTACCTTC |
Rev primer name |
SPAC22G7.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTGCTACTTCAGTAGCA |
Amino acid length |
2244 |
Molecular weight |
248.3 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSAVKKLAL/LGSVNGLTI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |