Gene name |
SPBC146.03c |
Gene ID |
34/A12 |
Gene synonyms/obsolete |
cut3 |
Gene product |
condensin subunit;
SMC4 subunit; essential; involved in chromosome segregation
(required) (mitosis); involved in chromosome condensation
(required) (mitosis); NTP binding motif; phosphorylated by
Cdc2p |
Entry clone |
Cloned |
ORF length (unspliced) |
3975 |
ORF length (spliced) |
|
Entry clone length |
3975 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1550A:G / 1736T:C /
3051T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC146.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGACAAGGGCATCTT |
Rev primer name |
SPBC146.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTGTAAGTATTTCCTTG |
Amino acid length |
1324 |
Molecular weight |
150.6 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSEIADLSL/LKLMSNLKL |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |