| Gene name |
SPBC8D2.20c |
| Gene ID |
34/A10 |
| Gene synonyms/obsolete |
sec31 |
| Gene product |
COPII-coated vesicle
component; WD repeat protein; involved in intracellular
protein transport; involved in secretory pathway (required);
involved in cell cycle progression (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3675 |
| ORF length (spliced) |
|
| Entry clone length |
3675 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2479C:T / 3449A:G /
3657G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC8D2.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACTGAAGGATATAAG |
| Rev primer name |
SPBC8D2.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTAGTAGACTTACTCAAA |
| Amino acid length |
1224 |
| Molecular weight |
132.4 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |