Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPBC12D12.04c
Gene ID 34/A04
Gene synonyms/obsolete sts6; pkc1; pck2
Gene product serine/threonine protein kinase; protein kinase C-like 2; non-essential; function overlapping with pck1; involved in cellular morphogenesis; involved in cell wall biosynthesis (required); involved in cell polarity (regulation) target of Rho1p; target of Rho2p; involved in cell wall alpha-glucan biosynthesis (requlation); C2 domain; similar to Sp pck1 (paralog)
Entry clone Cloned
ORF length (unspliced) 3051
ORF length (spliced)
Entry clone length 3051
No. of intron 0
Sequence status Finished
Sequence results 648C:T / 1215T:C / 1862T:C
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPBC12D12.04.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGGATATGATTGATGAGGC
Rev primer name SPBC12D12.04.Rv
Rev primer SEQ AGAAAGCTGGGTAAGCATTATCGGTAGTCGAG
Amino acid length 1016
Molecular weight 116
Isoelectric point (calc.) 8.1
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) LEERLEKLKL/LLLPVGLLWI
Localization (YFP) periphery at cell tip and site of septum formation
Comments for localization
Effect of LMB on protein localization changed to: intranuclear microtubule bundle (nucleus>>cytosol; periphery at site of septum formation and cell tip)
Microscope used for observation Confocal

Image information
YFP 2 images) See all images
LMB 4 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.