Gene name |
SPBC12D12.04c |
Gene ID |
34/A04 |
Gene synonyms/obsolete |
sts6; pkc1; pck2 |
Gene product |
serine/threonine
protein kinase; protein kinase C-like 2; non-essential;
function overlapping with pck1; involved in cellular
morphogenesis; involved in cell wall biosynthesis (required);
involved in cell polarity (regulation) target of Rho1p; target
of Rho2p; involved in cell wall alpha-glucan biosynthesis
(requlation); C2 domain; similar to Sp pck1 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
3051 |
ORF length (spliced) |
|
Entry clone length |
3051 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
648C:T / 1215T:C /
1862T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC12D12.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATGATTGATGAGGC |
Rev primer name |
SPBC12D12.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCATTATCGGTAGTCGAG |
Amino acid length |
1016 |
Molecular weight |
116 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEERLEKLKL/LLLPVGLLWI |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol;
periphery at site of septum formation and cell tip) |
Microscope used for
observation |
Confocal |