| Gene name |
SPBC17D11.05 |
| Gene ID |
34/A01 |
| Gene synonyms/obsolete |
tif32 |
| Gene product |
translation initiation
factor (eiF3 p110 subunit); PCI domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2844 |
| ORF length (spliced) |
2799 |
| Entry clone length |
2844 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
124G:A / 441T:G /
821A:T / 826T:C / 2668T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17D11.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACCTCCTCAAGGAAA |
| Rev primer name |
SPBC17D11.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGTTGTTGTTGATTACGT |
| Amino acid length |
932 |
| Molecular weight |
107 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEVEFHPLSI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |