| Gene name |
SPBC651.01c |
| Gene ID |
33/G04 |
| Gene synonyms/obsolete |
SPBC725.18c |
| Gene product |
GTPase; GTP-binding
protein; GTP1/OBG family; NOG subfamily; involved in ribosome
biogenesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2293 |
| ORF length (spliced) |
1929 |
| Entry clone length |
2293 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
379G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC651.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAACGGCAGTGTTCAA |
| Rev primer name |
SPBC651.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTTCTTTGAGTTTTACCG |
| Amino acid length |
642 |
| Molecular weight |
72.7 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
spindle microtubules;
nucleolus |
| Comments for localization |
large and bright
structure |
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleolus) |
| Microscope used for
observation |
DeltaVision |