Gene name |
SPBC651.01c |
Gene ID |
33/G04 |
Gene synonyms/obsolete |
SPBC725.18c |
Gene product |
GTPase; GTP-binding
protein; GTP1/OBG family; NOG subfamily; involved in ribosome
biogenesis |
Entry clone |
Cloned |
ORF length (unspliced) |
2293 |
ORF length (spliced) |
1929 |
Entry clone length |
2293 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
379G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC651.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAACGGCAGTGTTCAA |
Rev primer name |
SPBC651.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTTCTTTGAGTTTTACCG |
Amino acid length |
642 |
Molecular weight |
72.7 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
spindle microtubules;
nucleolus |
Comments for localization |
large and bright
structure |
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleolus) |
Microscope used for
observation |
DeltaVision |