| Gene name |
SPBC16H5.11c |
| Gene ID |
33/F07 |
| Gene synonyms/obsolete |
skb1 |
| Gene product |
protein
methyltransferase; interacts physically with Shk1p; interacts
physically with Orb6p; involved in the regulation of cell
morphogenesis; involved in the regulation of mitosis
(negative); involved in osmotic stress |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2033 |
| ORF length (spliced) |
1938 |
| Entry clone length |
2033 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
825A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16H5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTATTGCGGGATGGCCG |
| Rev primer name |
SPBC16H5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACATATTACACGAGAAC |
| Amino acid length |
645 |
| Molecular weight |
73.1 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKFLVQLAI/LRAIYALYL |
| Localization (YFP) |
cytoplasmic dots at
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |