| Gene name |
SPAC458.01 |
| Gene ID |
33/F04 |
| Gene synonyms/obsolete |
SPAC17D4.04 |
| Gene product |
methyltransferase;
possibly methylates cytidine and tRNAs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2010 |
| ORF length (spliced) |
1965 |
| Entry clone length |
2010 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
281T:C / 498T:C /
1260T:C / 1317G:A / 1818A:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC458.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCAGATTATGTTTA |
| Rev primer name |
SPAC458.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTTTTTTCTGAATTCGAT |
| Amino acid length |
654 |
| Molecular weight |
74.5 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKALQEFLVL |
| Localization (YFP) |
nucleus>>cytosol; nuclear dots |
| Comments for localization |
nuclear dots by over
expression; weak signal of cytosol |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |