Gene name |
SPBC8D2.19 |
Gene ID |
33/E07 |
Gene synonyms/obsolete |
mde3 |
Gene product |
serine/threonine
protein kinase; positive regulator of meiotic genes; meiosis
specific transcription |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
1859 |
ORF length (spliced) |
1680 |
Entry clone length |
1859 |
No. of intron |
2 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC8D2.19.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAATGAAAGTATTTA |
Rev primer name |
SPBC8D2.19.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGCGAACTTAGATGTAAG |
Amino acid length |
559 |
Molecular weight |
63.2 |
Isoelectric point (calc.) |
9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLKLRESLAL |
Localization (YFP) |
periphery, especially
at cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |