Gene name |
SPBC2D10.18 |
Gene ID |
33/E04 |
Gene synonyms/obsolete |
abc1 |
Gene product |
involved in assembly
of the ubiquinol cytochrome-c reductase complex (cytochrome
bc1 complex); functionally complements Sc ABC1 |
Entry clone |
Cloned |
ORF length (unspliced) |
1833 |
ORF length (spliced) |
|
Entry clone length |
1833 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
231T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2D10.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAATTCAGGGCTTTG |
Rev primer name |
SPBC2D10.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGCGTAATGTTTCAAC |
Amino acid length |
610 |
Molecular weight |
68.5 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
17 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion;
periphery |
Comments for localization |
weak signal of
periphery |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |