Gene name |
SPAC16.02c |
Gene ID |
33/D01 |
Gene synonyms/obsolete |
srp2 |
Gene product |
RNA-binding protein;
involved in mRNA splicing; no apparent Sc ortholog; rrm RNA
recognition motif |
Entry clone |
Cloned |
ORF length (unspliced) |
1716 |
ORF length (spliced) |
1098 |
Entry clone length |
1716 |
No. of intron |
9 |
Sequence status |
Finished |
Sequence results |
857A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC16.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAGACTAGATTGTT |
Rev primer name |
SPAC16.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCATTCAGCAGCGACCTGT |
Amino acid length |
365 |
Molecular weight |
42.5 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
74 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
almost no apparent
signal; nucleus and mitochondrion? |
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |