Gene name |
SPBC12D12.01 |
Gene ID |
33/B06 |
Gene synonyms/obsolete |
sad1;
SPBC16H5.01c |
Gene product |
involved in spindle
formation; essential; no apparent Sc ortholog; associates with
the spindle pole body and may maintain a functional interface
between the nuclear membrane and the microtubule motor
proteins or may provide an anchor for these motor proteins;
eessential for viability. |
Entry clone |
Cloned |
ORF length (unspliced) |
1545 |
ORF length (spliced) |
|
Entry clone length |
1545 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
292A:G / 1135T:C /
1530T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC12D12.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTACTAATACACCGGT |
Rev primer name |
SPBC12D12.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGATGAATCTTGACCCGTA |
Amino acid length |
514 |
Molecular weight |
58 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nuclear envelope?
|
Comments for localization |
periphery? ER? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |