| Gene name |
SPBC1289.02c |
| Gene ID |
32/G04 |
| Gene synonyms/obsolete |
uap2 |
| Gene product |
U2 snRNA-associated
protein; involved in mRNA splicing; RNA-binding protein; rrm
RNA recognition motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1277 |
| ORF length (spliced) |
1104 |
| Entry clone length |
1277 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
756T:C / 868G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1289.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCAGCCAGCCTTTTTG |
| Rev primer name |
SPBC1289.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTAGAATTTTCTAACCAA |
| Amino acid length |
367 |
| Molecular weight |
41.9 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |