| Gene name |
SPBC14C8.06 |
| Gene ID |
32/F03 |
| Gene synonyms/obsolete |
sop2 |
| Gene product |
WD repeat protein;
essential; ARP2/3 actin-organizing complex; involved in
cytokinesis, septation, actin cortical patch assembly, actin
cortical patch distribution; interacts physically with Arp3p;
involved in regulation of profilin function |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1181 |
| ORF length (spliced) |
1134 |
| Entry clone length |
1181 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
52G:A / 259T:C /
631T:A / 1107G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC14C8.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACCTCTCAAGTTTT |
| Rev primer name |
SPBC14C8.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGTCCACAAAACAACA |
| Amino acid length |
377 |
| Molecular weight |
41.5 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; cytosol |
| Comments for localization |
aggregates by over
expression; probably actin cytoskeleton |
| Effect of LMB on protein
localization |
changed to:
cytoplasmic dots; cytosol=nucleus |
| Microscope used for
observation |
Leica |