| Gene name |
SPAC631.01c |
| Gene ID |
32/D06 |
| Gene synonyms/obsolete |
|
| Gene product |
F-actin capping
protein (beta subunit); involved in F-actin capping; actin
cortical patch component; involved in actin filament
organization |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1053 |
| ORF length (spliced) |
807 |
| Entry clone length |
1053 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
345T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC631.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGTAAGTATTACTGA |
| Rev primer name |
SPAC631.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGGAAAGATCGTTTAAA |
| Amino acid length |
268 |
| Molecular weight |
29.8 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNEAIRVYLDL/LRSVLNDLSI |
| Localization (YFP) |
nucleus>cytosol;
periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |