Gene name |
SPBC1347.03 |
Gene ID |
32/D04 |
Gene synonyms/obsolete |
meu14 |
Gene product |
involved in meiosis,
spore wall assembly, nuclear division (meiosis II); predicted
coiled-coil region; meiotic expression upregulated; Mei4p
dependent transcription |
Entry clone |
Cloned |
ORF length (unspliced) |
1049 |
ORF length (spliced) |
1008 |
Entry clone length |
1049 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1347.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCAAATCAAGCAACTT |
Rev primer name |
SPBC1347.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAAGAAAACAGTGGATTTT |
Amino acid length |
335 |
Molecular weight |
37.3 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery; SPB?; site
of septum formation |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |