Gene name |
SPBC8D2.14c |
Gene ID |
32/C11 |
Gene synonyms/obsolete |
sed5 |
Gene product |
SNARE; Required for
vesicular transport between the endoplasmic reticulum and the
Golgi complex; Acts as a target organelle soluble NSF
attachment protein receptor (t-SNARE) (By similarity); Belongs
to the syntaxin/epimorphin family; Contains 1 t-SNARE
coiled-coil homology domain. 1 predicted transmembrane helix;
similar to S. cerevisiae YLR026C |
Entry clone |
Cloned |
ORF length (unspliced) |
1021 |
ORF length (spliced) |
930 |
Entry clone length |
1021 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
946T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC8D2.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTTCAAGATAGGAC |
Rev primer name |
SPBC8D2.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTAACGAGCACCCAAAGA |
Amino acid length |
309 |
Molecular weight |
34.8 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
almost no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |