| Gene name |
SPBC365.06 |
| Gene ID |
31/E04 |
| Gene synonyms/obsolete |
pmt3; ubl2; smt3 |
| Gene product |
ubiquitin family
protein; SUMO-1 family; required for chromosome segregation
where it may be involved in microtubule assembly; loss of smt3
leads to an increase in telomere length. |
| Entry clone |
Cloned |
| ORF length (unspliced) |
497 |
| ORF length (spliced) |
354 |
| Entry clone length |
497 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC365.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAATCACCATCAGC |
| Rev primer name |
SPBC365.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGCATAGATGGGTGCAA |
| Amino acid length |
117 |
| Molecular weight |
12.9 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear dots;
SPB |
| Comments for localization |
observed by N-terminal
tagging of GFP with nmt41 promoter |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |