| Gene name |
SPBC14C8.12 |
| Gene ID |
31/E02 |
| Gene synonyms/obsolete |
rpb8 |
| Gene product |
DNA-directed RNA
polymerase (I, II, and III subunit); involved in transcription
from Pol I, II, and III promoter; DNA-directed RNA polymerase
activity; interacts physically with Rpb1p, Rpb3p, Rpb11p, and
Rpb6p |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
485 |
| ORF length (spliced) |
378 |
| Entry clone length |
485 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC14C8.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAATCCGTACTTTT |
| Rev primer name |
SPBC14C8.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTTCTAAGTAATAGATAA |
| Amino acid length |
125 |
| Molecular weight |
14.3 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
nucleolus as dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |