Gene name |
SPCC162.08c |
Gene ID |
31/B06 |
Gene synonyms/obsolete |
|
Gene product |
nuclear pore complex
associated; similar to Sp SPAC1486.04c; predicted coiled-coil
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
5514 |
ORF length (spliced) |
|
Entry clone length |
5514 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
434A:G / 2195T:C /
4386T:C / 4430A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC162.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCACGATTCTTCCTGGAC |
Rev primer name |
SPCC162.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTGCTTTCTTTTGGTTC |
Amino acid length |
1837 |
Molecular weight |
211.4 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNDLEKSLVL/LQRTVRNQLEI/LQSTVDSLQL |
Localization (YFP) |
nucleus; nuclear
envelope |
Comments for localization |
large nuclear dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |