| Gene name |
SPCC1183.07 |
| Gene ID |
31/B04 |
| Gene synonyms/obsolete |
|
| Gene product |
RNA-binding protein;
S1 RNA binding domain; ribonucleoprotein (RNP) complex;
processome component; involved in rRNA processing |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
5073 |
| ORF length (spliced) |
|
| Entry clone length |
5073 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1183.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGGAAATAAAAGAAA |
| Rev primer name |
SPCC1183.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTCAGAATGGCTCTCA |
| Amino acid length |
1690 |
| Molecular weight |
187.5 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNVWMALLNL/LFQRLLALNL |
| Localization (YFP) |
nucleolus |
| Comments for localization |
very strong signal by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |