Gene name |
SPAC3G9.12 |
Gene ID |
30/H09 |
Gene synonyms/obsolete |
|
Gene product |
CLASP family
microtubule-associated protein Cls1; HEAT repeat |
Entry clone |
Cloned |
ORF length (unspliced) |
4510 |
ORF length (spliced) |
4389 |
Entry clone length |
4510 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
226T:A / 792T:C /
1272A:G / 2069A:G / 2380A:G / 2565T:C / 4323A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G9.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGATAAGGATGCGCA |
Rev primer name |
SPAC3G9.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCTTTTCATCAGACTTC |
Amino acid length |
1462 |
Molecular weight |
164 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTVNPLLL/LQSLVEELSL/LPGILLALLSL/LKSNIDPFLEL/LEPSVLKQLHL |
Localization (YFP) |
nucleus>>cytosol; nuclear envelope;
microtubules?; SPB? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |